Table 2 List of well-studied miRNAs associated with various types of cancer. (http://mirwalk.umm.uni-heidelberg.de/human/mirna/MIMAT0000437/)
mRNAs | Function | Related disease | Sequence (with Refseqid) | Effects | Conclusions | Reference |
|---|---|---|---|---|---|---|
miR-21 | Oncogenic miRNA | Elevated levels in various cancers, including breast, colorectal, lung, and pancreatic cancer | UAGCUUAUCAGACUGAUGUUGA (NM_015000) | Promotes tumor growth and survival by targeting tumor suppressor genes | Potential therapeutic target due to its role in multiple cancer types | |
miR-34a | Tumor suppressor miRNA | Downregulated in multiple cancers, including lung, breast, and prostate cancer | UGGCAGUGUCUUAGCUGGUUGU (NM_001256426) | Inhibits tumor growth and promotes apoptosis; loss contributes to cancer progression | Restoration of miR-34a levels could suppress tumor growth | |
miR-155 | Oncogenic miRNA | Overexpressed in lymphoma, leukemia, breast, lung, and pancreatic cancer | UUAAUGCUAAUCGUGAUAGGGGUU(NM_001271900) | Enhances cancer cell proliferation and survival by targeting tumor suppressors | A promising target for cancer therapy, especially in hematological malignancies | [73] |
miR-200 family (miR-200a, miR-200b, miR-200c, miR-141, miR-429) | Tumor suppressor miRNAs | Involved in epithelial-mesenchymal transition (EMT) and metastasis in various cancers | CAUCUUACUGGGCAGCAUUGGA (NM_004136) | Regulates EMT and metastasis; downregulation facilitates cancer progression | Reinstating miR-200 expression might inhibit metastasis | [74] |
miR-17-92 cluster | Oncogenic miRNA cluster | Overexpression in several cancers, including lymphoma, lung, and breast cancer | CAAAGUGCUUACAGUGCAGGUAG (NM_001366280) | Promotes cell proliferation and survival; dysregulation contributes to tumorigenesis | Potential target for interventions aimed at multiple cancer types | [75] |
let-7 family (let-7a, let-7b, let-7c) | Tumor suppressor miRNAs | Downregulated in various cancers, including lung, ovarian, and colorectal cancer | UGAGGUAGUAGGUUGUAUAGUU (NM_001348204) UGAGGUAGUAGGUUGUGUGGUU (NM_015279) UGAGGUAGUAGGUUGUAUGGUU (NM_001330410) | Inhibits tumor growth; loss of let-7 contributes to increased tumorigenesis | Restoration of let-7 levels could have therapeutic benefits | [76] |
miR-221/222 | Oncogenic miRNAs | Elevated levels in glioblastoma, breast, and hepatocellular carcinoma | ACCUGGCAUACAAUGUAGAUUU(NM_001268284) CUCAGUAGCCAGUGUAGAUCCU(NM_001256426) | Promotes tumor growth and metastasis by targeting multiple tumor suppressor genes | Targeting miR-221/222 may help in treating various cancers | [77] |
miR-10b | Oncogenic miRNA | Associated with invasion and metastasis in breast cancer | UACCCUGUAGAUCCGAAUUUGUG(NM_001256426) | Enhances invasion and metastasis; plays a role in cancer progression | A potential therapeutic target for preventing cancer metastasis | [78] |
miR-143/145 | Tumor suppressor miRNAs | Downregulated in colorectal and other cancers | GUCCAGUUUUCCCAGGAAUCCCU(NM_032359) | Inhibits cancer cell proliferation and promotes apoptosis | Restoring miR-143/145 levels could suppress tumor growth | [79] |
miR-210 | Oncogenic miRNA | Overexpressed in various cancers, including lung, breast, and renal cell carcinoma | AGCCCCUGCCCACCGCACACUG(NM_013321) | Enhances tumor survival and resistance to hypoxia; contributes to cancer progression | Potential therapeutic target due to its role in multiple cancer types | [80] |
miR-126 | Tumor suppressor miRNA | Downregulated in several cancers, including lung, breast, and pancreatic cancer | CAUUAUUACUUUUGGUACGCG(NM_001256549) | Inhibits tumor angiogenesis and proliferation; its downregulation promotes cancer | Reinstating miR-126 may suppress tumor growth and angiogenesis | [81] |
miR-221/222 | Oncogenic miRNAs | Elevated levels in glioblastoma, breast, and hepatocellular carcinoma | ACCUGGCAUACAAUGUAGAUUU(NM_001268284) CUCAGUAGCCAGUGUAGAUCCU(NM_001256426) | Promotes tumor growth and metastasis by targeting multiple tumor suppressor genes | Â | [82] |
miR-31 | Oncogenic miRNA | Associated with metastasis in colorectal and breast cancer | AGGCAAGAUGCUGGCAUAGCU(NM_001256426) | Promotes metastasis by influencing cancer cell migration and invasion | Potential target for therapies aimed at reducing cancer metastasis | [83] |
miR-29 family (miR-29a, miR-29b, miR-29c) | Tumor suppressor miRNAs | Downregulated in various cancers, including Intra-Hepatic Cholangiocarcinoma, leukemia, lung, and pancreatic cancer | ACUGAUUUCUUUUGGUGUUCAG (NM_001256793) | Regulates cell proliferation, apoptosis, and differentiation | Restoration of miR-29 levels could be beneficial in treating various cancers | [84] |